Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 2913273
End position: 2913296
Length: 24

DNA sequence
>NC_009720, from 2913273 to 2913296 (24 bp); Xanthobacter autotrophicus Py2 CGCCGCCGCCACCGCCACCGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2912506-2913765	Sequence	Xaut_2625 - aspartate kinase (Protein is coded in complementary strand; from 2913765 to 2912506)