Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 2893510
End position: 2893545
Length: 36

DNA sequence
>NC_009720, from 2893510 to 2893545 (36 bp); Xanthobacter autotrophicus Py2 GGCGGCTTCGGCGGCGTCCTCGGCGGCGGCATCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2893502-2894113	Sequence	Xaut_2607 - 50S ribosomal protein L25/general stress protein Ctc (Protein is coded in complementary strand; from 2894113 to 2893502)