Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 2828429
End position: 2828464
Length: 36

DNA sequence
>NC_009720, from 2828429 to 2828464 (36 bp); Xanthobacter autotrophicus Py2 GGGCTGGGATTGGGGCTGGGATTGGCGCTGGGATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2827403-2828494	Sequence	Xaut_2530 - lysine--tRNA ligase (Protein is coded in complementary strand; from 2828494 to 2827403)