Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 2778095
End position: 2778118
Length: 24

DNA sequence
>NC_009720, from 2778095 to 2778118 (24 bp); Xanthobacter autotrophicus Py2 CCGCGCCGGCGCCCACGCACGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2777656-2778438	Sequence	Xaut_2485 - enoyl-CoA hydratase/isomerase (Protein is coded in complementary strand; from 2778438 to 2777656)