Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 2649608
End position: 2649631
Length: 24

DNA sequence
>NC_009720, from 2649608 to 2649631 (24 bp); Xanthobacter autotrophicus Py2 CGCCCACGGCCACGTCCACGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2648785-2649708	Sequence	Xaut_2373 - phage SPO1 DNA polymerase-like protein (Protein is coded in complementary strand; from 2649708 to 2648785)