Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 2390762
End position: 2390785
Length: 24

DNA sequence
>NC_009720, from 2390762 to 2390785 (24 bp); Xanthobacter autotrophicus Py2 CGAGGGCCAGGGCGAGGCCGAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2388712-2391225	Sequence	Xaut_2129 - ATP-dependent helicase HrpB (Protein is coded in complementary strand; from 2391225 to 2388712)