Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 2321685
End position: 2321708
Length: 24

DNA sequence
>NC_009720, from 2321685 to 2321708 (24 bp); Xanthobacter autotrophicus Py2 GGCGGCGGGGGCGGCGGAGGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2321673-2322221	Sequence	Xaut_2064 - hypothetical protein (Protein is coded in complementary strand; from 2322221 to 2321673)