Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 2274358
End position: 2274393
Length: 36

DNA sequence
>NC_009720, from 2274358 to 2274393 (36 bp); Xanthobacter autotrophicus Py2 GACGGACCTGAATACGGACCTTAATACGGACCCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2274270-2275169	Sequence	Xaut_2016 - ubiquinone/menaquinone biosynthesis methyltransferase