Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 2179014
End position: 2179037
Length: 24

DNA sequence
>NC_009720, from 2179014 to 2179037 (24 bp); Xanthobacter autotrophicus Py2 CGAAGCCCAAGCCCAAGCCGAAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2177565-2179091	Sequence	Xaut_1925 - Serine-type D-Ala-D-Ala carboxypeptidase