Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 213912
End position: 213956
Length: 45

DNA sequence
>NC_009720, from 213912 to 213956 (45 bp); Xanthobacter autotrophicus Py2 CGCCTCGCTCACCGGCTTCTCGCTCACCGGTCCTTCGCTCACCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 211204-213954	Sequence	Xaut_0210 - ABC transporter-like protein (Protein is coded in complementary strand; from 213954 to 211204)