Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 2129984
End position: 2130028
Length: 45

DNA sequence
>NC_009720, from 2129984 to 2130028 (45 bp); Xanthobacter autotrophicus Py2 TACGCCCAGCAGGGCTACGGGCAGCAAGGCTATCCCCAGCAGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2129625-2130461	Sequence	Xaut_1890 - putative periplasmic ligand-binding sensor protein