Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 1991077
End position: 1991100
Length: 24

DNA sequence
>NC_009720, from 1991077 to 1991100 (24 bp); Xanthobacter autotrophicus Py2 AGGCTTGGGCTTCGGCTTCGGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1990985-1991794	Sequence	Xaut_1765 - hypothetical protein (Protein is coded in complementary strand; from 1991794 to 1990985)