Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 1852308
End position: 1852352
Length: 45

DNA sequence
>NC_009720, from 1852308 to 1852352 (45 bp); Xanthobacter autotrophicus Py2 CGGCAGGCGTCACCGGAGCAGGTGTCACCGGGGCAGGCGTCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1850567-1852351	Sequence	Xaut_1633 - shikimate kinase., 3-dehydroquinate synthase (Protein is coded in complementary strand; from 1852351 to 1850567)