Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 1726413
End position: 1726457
Length: 45

DNA sequence
>NC_009720, from 1726413 to 1726457 (45 bp); Xanthobacter autotrophicus Py2 CCCCCGTCAAATGCATTCTCGTCAAATGCACTCCCGTCAAACGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1726049-1726468	Sequence	Xaut_1516 - cytochrome c553-like protein (Protein is coded in complementary strand; from 1726468 to 1726049)