Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 1631794
End position: 1631818
Length: 25

DNA sequence
>NC_009720, from 1631794 to 1631818 (25 bp); Xanthobacter autotrophicus Py2 CGCGCCGCGGAGCGCCGCGCCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1631364-1632290	Sequence	Xaut_1424 - ribosomal L11 methyltransferase (Protein is coded in complementary strand; from 1632290 to 1631364)