Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 1455920
End position: 1455943
Length: 24

DNA sequence
>NC_009720, from 1455920 to 1455943 (24 bp); Xanthobacter autotrophicus Py2 GCCGCCACCGCCACCGCCGTCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1455090-1455992	Sequence	Xaut_1265 - hypothetical protein (Protein is coded in complementary strand; from 1455992 to 1455090)