Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 1328054
End position: 1328098
Length: 45

DNA sequence
>NC_009720, from 1328054 to 1328098 (45 bp); Xanthobacter autotrophicus Py2 AGCAGGAGAGCGGCAAGCACGCGAGCGGCAAGCAAGACGGCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1327040-1328131	Sequence	Xaut_1154 - hypothetical protein (Protein is coded in complementary strand; from 1328131 to 1327040)