Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 1317197
End position: 1317223
Length: 27

DNA sequence
>NC_009720, from 1317197 to 1317223 (27 bp); Xanthobacter autotrophicus Py2 GGGGCGGGCGAGGCGGGCGGGGCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1316138-1317271	Sequence	Xaut_1145 metN DL-methionine transporter ATP-binding subunit (Protein is coded in complementary strand; from 1317271 to 1316138)