Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 1222928
End position: 1222952
Length: 25

DNA sequence
>NC_009720, from 1222928 to 1222952 (25 bp); Xanthobacter autotrophicus Py2 CCCGGCCCGCTCCGGCCGGGTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1221009-1224683	Sequence	Xaut_1067 - peptidase S8/S53 subtilisin kexin sedolisin