Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 1181467
End position: 1181490
Length: 24

DNA sequence
>NC_009720, from 1181467 to 1181490 (24 bp); Xanthobacter autotrophicus Py2 GATGACGATGCCGATGGCGATGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1180775-1182088	Sequence	Xaut_1028 - major facilitator transporter (Protein is coded in complementary strand; from 1182088 to 1180775)