Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 715633
End position: 715692
Length: 60

DNA sequence
>NC_009720, from 715633 to 715692 (60 bp); Xanthobacter autotrophicus Py2 GGTGGCCTCCTGTACCGTGGCCTCCTGTACCGTGGCCTCCTGCGCCGTGGCCTCCTGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 714779-715792	Sequence	Xaut_0635 - hypothetical protein (Protein is coded in complementary strand; from 715792 to 714779)