Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 4848042
End position: 4848066
Length: 25

DNA sequence
>NC_009720, from 4848042 to 4848066 (25 bp); Xanthobacter autotrophicus Py2 GGCGGAGCGGGGCGTGGCGAGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4847578-4848291	Sequence	Xaut_4371 - LexA repressor (Protein is coded in complementary strand; from 4848291 to 4847578)