Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 564784
End position: 564807
Length: 24

DNA sequence
>NC_009720, from 564784 to 564807 (24 bp); Xanthobacter autotrophicus Py2 GCCATCGCCATCGCCACCGCCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 564173-565126	Sequence	Xaut_0509 - acetyl-CoA carboxylase carboxyltransferase subunit alpha