Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 1875942
End position: 1875965
Length: 24

DNA sequence
>NC_009720, from 1875942 to 1875965 (24 bp); Xanthobacter autotrophicus Py2 CGCCCTCGCCCTCGCCTTCGCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1875920-1877905	Sequence	Xaut_1657 - cytochrome c-type biogenesis protein CcmF