Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 971751
End position: 971780
Length: 30

DNA sequence
>NC_009707, from 971751 to 971780 (30 bp); Campylobacter jejuni subsp. doylei 269.97 ATTTTAAAAAGTTTTGAAAAATTTAGAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 971341-972540	Sequence	JJD26997_1101 - site-specific recombinase phage integrase family protein