Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 915052
End position: 915078
Length: 27

DNA sequence
>NC_009707, from 915052 to 915078 (27 bp); Campylobacter jejuni subsp. doylei 269.97 CACCATTACCTCCATTACCTCCATTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 912138-915392	Sequence	JJD26997_1041 - autotransporter beta-domain-containing protein (Protein is coded in complementary strand; from 915392 to 912138)