Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 881793
End position: 881822
Length: 30

DNA sequence
>NC_009707, from 881793 to 881822 (30 bp); Campylobacter jejuni subsp. doylei 269.97 TAATTTTTGATAAATTTTGTTTTTTTTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 881549-882052	Sequence	JJD26997_1000 - hypothetical protein (Protein is coded in complementary strand; from 882052 to 881549)