Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 860500
End position: 860535
Length: 36

DNA sequence
>NC_009707, from 860500 to 860535 (36 bp); Campylobacter jejuni subsp. doylei 269.97 CCCTCATTTATCACCTCATTTATCACCTCATTTATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 860485-860610	Sequence	JJD26997_0976 - hypothetical protein (Protein is coded in complementary strand; from 860610 to 860485)