Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 838977
End position: 839000
Length: 24

DNA sequence
>NC_009707, from 838977 to 839000 (24 bp); Campylobacter jejuni subsp. doylei 269.97 GGTGGTGATGGTGGTGGTGATGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 838345-840537	Sequence	JJD26997_0940 - lectin C-type domain-containing protein