Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 595497
End position: 595520
Length: 24

DNA sequence
>NC_009707, from 595497 to 595520 (24 bp); Campylobacter jejuni subsp. doylei 269.97 AAAATTAAAATAACAATTAAAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 594429-595535	Sequence	JJD26997_0655 - putative membrane-associated zinc metalloprotease (Protein is coded in complementary strand; from 595535 to 594429)