Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 41
End position: 64
Length: 24

DNA sequence
>NC_009707, from 41 to 64 (24 bp); Campylobacter jejuni subsp. doylei 269.97 AAACGAAAACGAATACGAAAACTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-1323	Sequence	JJD26997_0001 dnaA chromosomal replication initiation protein