Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 308730
End position: 308756
Length: 27

DNA sequence
>NC_009707, from 308730 to 308756 (27 bp); Campylobacter jejuni subsp. doylei 269.97 CCAGAAGCACCAGAACCACCAGAACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 308286-310121	Sequence	JJD26997_0350 - hypothetical protein (Protein is coded in complementary strand; from 310121 to 308286)