Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 1630586
End position: 1630610
Length: 25

DNA sequence
>NC_009707, from 1630586 to 1630610 (25 bp); Campylobacter jejuni subsp. doylei 269.97 TTTTGTTTTTTCTTGATTTGTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1630194-1633163	Sequence	JJD26997_1853 - type I restriction enzyme EcoR124II R protein (Protein is coded in complementary strand; from 1633163 to 1630194)