Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 1535277
End position: 1535306
Length: 30

DNA sequence
>NC_009707, from 1535277 to 1535306 (30 bp); Campylobacter jejuni subsp. doylei 269.97 TTTGTTTTTATCTCTTTTTATTTTTTTATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1535176-1536297	Sequence	JJD26997_1745 - hypothetical protein (Protein is coded in complementary strand; from 1536297 to 1535176)