Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 1388811
End position: 1388834
Length: 24

DNA sequence
>NC_009707, from 1388811 to 1388834 (24 bp); Campylobacter jejuni subsp. doylei 269.97 AACTTTTTTACTTTTTAGCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1387645-1388880	Sequence	JJD26997_1569 serS seryl-tRNA synthetase (Protein is coded in complementary strand; from 1388880 to 1387645)