Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 122619
End position: 122654
Length: 36

DNA sequence
>NC_009707, from 122619 to 122654 (36 bp); Campylobacter jejuni subsp. doylei 269.97 GGCGGTGGCGGTTGCTGTGGCGGTGGCGGTGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 122119-122673	Sequence	JJD26997_0122 slyD FKBP-type peptidyl-prolyl cis-trans isomerase SlyD