Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 1226175
End position: 1226198
Length: 24

DNA sequence
>NC_009707, from 1226175 to 1226198 (24 bp); Campylobacter jejuni subsp. doylei 269.97 AAAATACTAAAATTCTAAAATATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1225922-1227724	Sequence	JJD26997_1384 - 3-octaprenyl-4-hydroxybenzoate carboxy-lyase (Protein is coded in complementary strand; from 1227724 to 1225922)