Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 1212387
End position: 1212431
Length: 45

DNA sequence
>NC_009707, from 1212387 to 1212431 (45 bp); Campylobacter jejuni subsp. doylei 269.97 AAATCACTTTTGATATAATCATTCTTGATATAATCATTCTTGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1211544-1214411	Sequence	JJD26997_1370 - autotransporter beta-domain-containing protein (Protein is coded in complementary strand; from 1214411 to 1211544)