Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 1161684
End position: 1161711
Length: 28

DNA sequence
>NC_009707, from 1161684 to 1161711 (28 bp); Campylobacter jejuni subsp. doylei 269.97 GAATTTAGAATTTTGAAATTAAAATTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1161348-1161839	Sequence	JJD26997_1314 - hypothetical protein (Protein is coded in complementary strand; from 1161839 to 1161348)