Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 1058341
End position: 1058385
Length: 45

DNA sequence
>NC_009707, from 1058341 to 1058385 (45 bp); Campylobacter jejuni subsp. doylei 269.97 CACCAAAGGAAAAATAGCCAAAGGCAAAATCACTAAAGCAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1057142-1058884	Sequence	JJD26997_1207 - putative ABC transporter ATP-binding protein/permease MsbA (Protein is coded in complementary strand; from 1058884 to 1057142)