Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 1042065
End position: 1042094
Length: 30

DNA sequence
>NC_009707, from 1042065 to 1042094 (30 bp); Campylobacter jejuni subsp. doylei 269.97 AAAAATAAACCAAAATAAGCAAAATTATAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1041554-1042330	Sequence	JJD26997_1189 - A24 family peptidase (Protein is coded in complementary strand; from 1042330 to 1041554)