Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 103728
End position: 103772
Length: 45

DNA sequence
>NC_009707, from 103728 to 103772 (45 bp); Campylobacter jejuni subsp. doylei 269.97 CCAGTGATTATATCAAGAATGATTATATCAAGAATGATTATATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 101520-104627	Sequence	JJD26997_0096 - autotransporter beta-domain-containing protein