Sequence retrieval

Genome: Campylobacter jejuni subsp. doylei 269.97
Start position: 1017616
End position: 1017648
Length: 33

DNA sequence
>NC_009707, from 1017616 to 1017648 (33 bp); Campylobacter jejuni subsp. doylei 269.97 AAAATTTTTCTAAAGTTTTTTTAAAATTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1017153-1017887	Sequence	JJD26997_1166 - hypothetical protein (Protein is coded in complementary strand; from 1017887 to 1017153)