Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 994540
End position: 994587
Length: 48

DNA sequence
>NC_009665, from 994540 to 994587 (48 bp); Shewanella baltica OS185 ATGCTCGAATGCTCGAATGCTCGAATGCTCGAATGCTCGAATGCTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 993525-994541	Sequence	Shew185_0836 - response regulator receiver modulated metal dependent phosphohydrolase