Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 933569
End position: 933613
Length: 45

DNA sequence
>NC_009665, from 933569 to 933613 (45 bp); Shewanella baltica OS185 AGAGAGCCACTTAGCAGAGAACCGCTTAACAAAGATCCACTCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 932879-933601	Sequence	Shew185_0797 modB molybdate ABC transporter permease (Protein is coded in complementary strand; from 933601 to 932879)