Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 704204
End position: 704239
Length: 36

DNA sequence
>NC_009665, from 704204 to 704239 (36 bp); Shewanella baltica OS185 TAATGCTTTAAATAATGTTTTAAATAATGCTTTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 702634-705480	Sequence	Shew185_0590 - P pilus assembly protein porin PapC-like protein