Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 5142096
End position: 5142149
Length: 54

DNA sequence
>NC_009665, from 5142096 to 5142149 (54 bp); Shewanella baltica OS185 GTTCCACCACCTGTACCTGTTCCACCACCTGTACCTGTTCCACCACCTGTACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5141199-5143412	Sequence	Shew185_4310 - TonB-dependent receptor plug (Protein is coded in complementary strand; from 5143412 to 5141199)