Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 4838392
End position: 4838427
Length: 36

DNA sequence
>NC_009665, from 4838392 to 4838427 (36 bp); Shewanella baltica OS185 CTTATGCTTATGCTTATGCTTATGCTTATGCTTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4838424-4838999	Sequence	Shew185_4056 - carbohydrate kinase (Protein is coded in complementary strand; from 4838999 to 4838424)