Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 4523144
End position: 4523188
Length: 45

DNA sequence
>NC_009665, from 4523144 to 4523188 (45 bp); Shewanella baltica OS185 TGGGGCATTGATATTTGTCGCATTGATGTTTGGCACATGGATATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4522518-4524275	Sequence	Shew185_3804 - formate--tetrahydrofolate ligase (Protein is coded in complementary strand; from 4524275 to 4522518)