Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 4120967
End position: 4121008
Length: 42

DNA sequence
>NC_009665, from 4120967 to 4121008 (42 bp); Shewanella baltica OS185 GCATTTAGCATTTAGCATTTAGCATTTAGCATTTAGCATTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4121007-4121444	Sequence	Shew185_3470 - thioesterase superfamily protein (Protein is coded in complementary strand; from 4121444 to 4121007)